Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 101444
End position: 101470
Length: 27

DNA sequence
>NC_014222, from 101444 to 101470 (27 bp); Methanococcus voltae A3 TTCTTCGTATTCTTCGTATTCTTCGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 99999-101852	Sequence	Mvol_0098 - fumarate reductase/succinate dehydrogenase flavoprotein domain-containing protein (Protein is coded in complementary strand; from 101852 to 99999)