Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 976310
End position: 976333
Length: 24

DNA sequence
>NC_014210, from 976310 to 976333 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CAGGAGGAGGAGCTGGAGCAGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 975234-976448	Sequence	Ndas_0794 - type 12 methyltransferase (Protein is coded in complementary strand; from 976448 to 975234)