Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 922303
End position: 922332
Length: 30

DNA sequence
>NC_014210, from 922303 to 922332 (30 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 ACACCACCCCCCACCACCCCCCACCACACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 922297-923616	Sequence	Ndas_0752 - extracellular solute-binding protein