Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 856328
End position: 856359
Length: 32

DNA sequence
>NC_014210, from 856328 to 856359 (32 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CTCAGCCGCTCAGCCCTTCAGCCGCTCAACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 856354-857955	Sequence	Ndas_0695 - alpha amylase catalytic subunit (Protein is coded in complementary strand; from 857955 to 856354)