Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 854573
End position: 854596
Length: 24

DNA sequence
>NC_014210, from 854573 to 854596 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CCTCGGCCCCGGCCTCGGCCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 854431-855678	Sequence	Ndas_0694 - family 1 extracellular solute-binding protein (Protein is coded in complementary strand; from 855678 to 854431)