Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 781051
End position: 781077
Length: 27

DNA sequence
>NC_014210, from 781051 to 781077 (27 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CGACCCGCCCGACCCGGCGGACCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 780237-781259	Sequence	Ndas_0634 - oligopeptide/dipeptide ABC transporter ATPase