Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 765786
End position: 765815
Length: 30

DNA sequence
>NC_014210, from 765786 to 765815 (30 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CGCCACCCCCACCGCCCCCGCCGCCGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 765346-766530	Sequence	Ndas_0624 - amidohydrolase (Protein is coded in complementary strand; from 766530 to 765346)