Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 642281
End position: 642304
Length: 24

DNA sequence
>NC_014210, from 642281 to 642304 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GCCGTGCCCGTGCCCGTGGTCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 641397-642317	Sequence	Ndas_0525 - cation diffusion facilitator family transporter (Protein is coded in complementary strand; from 642317 to 641397)