Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 638306
End position: 638389
Length: 84

DNA sequence
>NC_014210, from 638306 to 638389 (84 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 TCCTCGGCGTGGTCGTGGCCCTCCTCGCCGTGGCCGTGCTCCTCCTCGCCGTGGCCGTGCTCCTCCTCGG CGTGCTCGTCACCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 637733-638782	Sequence	Ndas_0522 - periplasmic solute binding protein (Protein is coded in complementary strand; from 638782 to 637733)