Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 5739233
End position: 5739268
Length: 36

DNA sequence
>NC_014210, from 5739233 to 5739268 (36 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GCTCGTCGCTCGGCTCGTCGCTCTCCTCGGCGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5738917-5741853	Sequence	Ndas_4845 - glycosyl transferase family 51 (Protein is coded in complementary strand; from 5741853 to 5738917)