Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 5709344
End position: 5709367
Length: 24

DNA sequence
>NC_014210, from 5709344 to 5709367 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GGCGCGGGAGCGGGAGCGGGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5708369-5710567	Sequence	Ndas_4819 - DNA polymerase III subunits gamma and tau (Protein is coded in complementary strand; from 5710567 to 5708369)