Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 5678069
End position: 5678122
Length: 54

DNA sequence
>NC_014210, from 5678069 to 5678122 (54 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 TCGGAGCACGCGGACCACGAGGAGCAGGCGGACCACGCGGGGCACGAGGACCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5677263-5678732	Sequence	Ndas_4790 - propeptide PepSY amd peptidase M4