Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 5551510
End position: 5551545
Length: 36

DNA sequence
>NC_014210, from 5551510 to 5551545 (36 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GGTCCCCGCGGTCACCGCGGTCACCGCGTTCCCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5551455-5552654	Sequence	Ndas_4675 - daunorubicin resistance ABC transporter ATPase (Protein is coded in complementary strand; from 5552654 to 5551455)