Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 5543517
End position: 5543579
Length: 63

DNA sequence
>NC_014210, from 5543517 to 5543579 (63 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GTGGGGTACTCGGGGTTCTCGGTGGGGTAGCCGGGGTCCTCAGAGGGGTACTCGGGAACCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5543376-5544077	Sequence	Ndas_4666 - hypothetical protein (Protein is coded in complementary strand; from 5544077 to 5543376)