Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 5525507
End position: 5525533
Length: 27

DNA sequence
>NC_014210, from 5525507 to 5525533 (27 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 TCCGCGTCCTCCGCGTCCTCCGCGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 5524443-5525507	Sequence	Ndas_4650 - MerR family transcriptional regulator (Protein is coded in complementary strand; from 5525507 to 5524443)
ORF. 5525501-5526292	Sequence	Ndas_4651 - hypothetical protein (Protein is coded in complementary strand; from 5526292 to 5525501)