Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 5371862
End position: 5371885
Length: 24

DNA sequence
>NC_014210, from 5371862 to 5371885 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GTCAGCAGGTCAGCGGATCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 5371880-5373517	Sequence	Ndas_4531 - D-alanyl-D-alaninecarboxypeptidase/D-alanyl-D-alanine-endopeptidase (Protein is coded in complementary strand; from 5373517 to 5371880)