Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 5362583
End position: 5362606
Length: 24

DNA sequence
>NC_014210, from 5362583 to 5362606 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GGACGCGGACCCGGTCGCCGACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5362009-5362944	Sequence	Ndas_4519 - hypothetical protein (Protein is coded in complementary strand; from 5362944 to 5362009)