Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 5297550
End position: 5297585
Length: 36

DNA sequence
>NC_014210, from 5297550 to 5297585 (36 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 TCCTCCGCGGGTTCCTCCTCCGGTTCCTCGGAGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5297523-5299067	Sequence	Ndas_4458 - metallophosphoesterase (Protein is coded in complementary strand; from 5299067 to 5297523)