Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 5262122
End position: 5262145
Length: 24

DNA sequence
>NC_014210, from 5262122 to 5262145 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GACCTCGTCCTCGTCCTCGCCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5261256-5263544	Sequence	Ndas_4421 - copper-translocating P-type ATPase (Protein is coded in complementary strand; from 5263544 to 5261256)