Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 5246297
End position: 5246323
Length: 27

DNA sequence
>NC_014210, from 5246297 to 5246323 (27 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GGCGCGGTCGGCCCGGTCGGCGCGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5246133-5246984	Sequence	Ndas_4409 - hypothetical protein (Protein is coded in complementary strand; from 5246984 to 5246133)