Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 5212130
End position: 5212156
Length: 27

DNA sequence
>NC_014210, from 5212130 to 5212156 (27 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GGCGGTTCGGGCGGTTCGGGCGGTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5211462-5212526	Sequence	Ndas_4377 - hypothetical protein