Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 5183620
End position: 5183643
Length: 24

DNA sequence
>NC_014210, from 5183620 to 5183643 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 TCGTCCTCGGCCGCGTCCTCCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5182405-5184555	Sequence	Ndas_4349 - hypothetical protein (Protein is coded in complementary strand; from 5184555 to 5182405)