Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 5084047
End position: 5084091
Length: 45

DNA sequence
>NC_014210, from 5084047 to 5084091 (45 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 AACTCGGCCGTCGGCTGCTCGGCCGTCGACTGCTCGGCCGTCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5083531-5084214	Sequence	Ndas_4268 - hypothetical protein (Protein is coded in complementary strand; from 5084214 to 5083531)