Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 503048
End position: 503071
Length: 24

DNA sequence
>NC_014210, from 503048 to 503071 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CGGCGGCGTCGGCGACGGCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 502231-503478	Sequence	Ndas_0410 - alanine racemase (Protein is coded in complementary strand; from 503478 to 502231)