Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 4995151
End position: 4995177
Length: 27

DNA sequence
>NC_014210, from 4995151 to 4995177 (27 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CGCCCAGGGCGGCCAGGGCGTCCAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4993674-4996928	Sequence	Ndas_4183 - ATP-binding region ATPase domain-containing protein (Protein is coded in complementary strand; from 4996928 to 4993674)