Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 4965644
End position: 4965667
Length: 24

DNA sequence
>NC_014210, from 4965644 to 4965667 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GGCCCCGGCCCTGGCCGCGGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4964910-4965815	Sequence	Ndas_4158 - ribokinase (Protein is coded in complementary strand; from 4965815 to 4964910)