Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 4880917
End position: 4880940
Length: 24

DNA sequence
>NC_014210, from 4880917 to 4880940 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CCTCGGCCTCGCGCTCGGCCTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4880841-4881485	Sequence	Ndas_4082 - hypothetical protein (Protein is coded in complementary strand; from 4881485 to 4880841)