Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 4824434
End position: 4824457
Length: 24

DNA sequence
>NC_014210, from 4824434 to 4824457 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GCGGTCGCGGCCGCGGACGAGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4824075-4824530	Sequence	Ndas_4030 - hypothetical protein (Protein is coded in complementary strand; from 4824530 to 4824075)