Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 4760641
End position: 4760664
Length: 24

DNA sequence
>NC_014210, from 4760641 to 4760664 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GACGGGGAAGGGGACGGCGCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4759913-4760842	Sequence	Ndas_3979 - sulfate adenylyltransferase, small subunit (Protein is coded in complementary strand; from 4760842 to 4759913)