Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 4634725
End position: 4634760
Length: 36

DNA sequence
>NC_014210, from 4634725 to 4634760 (36 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 TCGACGACTTCGTCGACCGCTTCGTCGACGAGTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4634656-4635003	Sequence	Ndas_3863 - hypothetical protein