Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 4556655
End position: 4556678
Length: 24

DNA sequence
>NC_014210, from 4556655 to 4556678 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CCACCGCCTCCGCCGCCGCCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4556517-4559540	Sequence	Ndas_3795 - hypothetical protein (Protein is coded in complementary strand; from 4559540 to 4556517)