Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 4549910
End position: 4549945
Length: 36

DNA sequence
>NC_014210, from 4549910 to 4549945 (36 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GGCGACGTCGGCCGCGACCTCGGCGGCGGAGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4549809-4550393	Sequence	Ndas_3788 - TetR family transcriptional regulator (Protein is coded in complementary strand; from 4550393 to 4549809)