Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 4538869
End position: 4538892
Length: 24

DNA sequence
>NC_014210, from 4538869 to 4538892 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GCGACGGTGACGGCGATGACGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4537858-4539906	Sequence	Ndas_3776 - hypothetical protein (Protein is coded in complementary strand; from 4539906 to 4537858)