Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 4438159
End position: 4438182
Length: 24

DNA sequence
>NC_014210, from 4438159 to 4438182 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CAGCAGGAGCAGCACCAGCAGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4437326-4438735	Sequence	Ndas_3699 - metal dependent phosphohydrolase (Protein is coded in complementary strand; from 4438735 to 4437326)