Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 4302379
End position: 4302408
Length: 30

DNA sequence
>NC_014210, from 4302379 to 4302408 (30 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CCGGGCGGGTCCGCGCGGGGTCAGGCGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 4301531-4302379	Sequence	Ndas_3588 - alpha/beta hydrolase
ORF... 4302400-4303287	Sequence	Ndas_3589 - tRNA pseudouridine synthase B (Protein is coded in complementary strand; from 4303287 to 4302400)