Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 4041345
End position: 4041371
Length: 27

DNA sequence
>NC_014210, from 4041345 to 4041371 (27 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 TCGTCGGACTCGGCGGACTCGTCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4039224-4042247	Sequence	Ndas_3381 - Rne/Rng family ribonuclease (Protein is coded in complementary strand; from 4042247 to 4039224)