Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 4007837
End position: 4007872
Length: 36

DNA sequence
>NC_014210, from 4007837 to 4007872 (36 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CAGGGTCGCGACCAGGGTGGCGGCCAGGATCGCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4007328-4008227	Sequence	Ndas_3353 - binding-protein-dependent transporters inner membrane component (Protein is coded in complementary strand; from 4008227 to 4007328)