Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 3965258
End position: 3965281
Length: 24

DNA sequence
>NC_014210, from 3965258 to 3965281 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CCAGGACCATGAGCAGGACCAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3962998-3965469	Sequence	Ndas_3318 - ATPase AAA (Protein is coded in complementary strand; from 3965469 to 3962998)