Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 3729521
End position: 3729544
Length: 24

DNA sequence
>NC_014210, from 3729521 to 3729544 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CGGCGGAGGCGGCCGCGGCGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3729238-3729918	Sequence	Ndas_3114 - thiamine-phosphate pyrophosphorylase (Protein is coded in complementary strand; from 3729918 to 3729238)