Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 3704492
End position: 3704521
Length: 30

DNA sequence
>NC_014210, from 3704492 to 3704521 (30 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GGCTCGGGCTCCGGCCCGGGGTCGGGCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3704426-3705367	Sequence	Ndas_3093 - hypothetical protein (Protein is coded in complementary strand; from 3705367 to 3704426)