Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 3693712
End position: 3693738
Length: 27

DNA sequence
>NC_014210, from 3693712 to 3693738 (27 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 TTGATGAGCTTGATGAGCTTGACGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3693424-3693816	Sequence	Ndas_3086 - hypothetical protein (Protein is coded in complementary strand; from 3693816 to 3693424)