Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 3672653
End position: 3672676
Length: 24

DNA sequence
>NC_014210, from 3672653 to 3672676 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 TCCTCGTACTCGTCCTCCTCCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3671495-3672865	Sequence	Ndas_3073 - aminodeoxychorismate lyase (Protein is coded in complementary strand; from 3672865 to 3671495)