Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 363874
End position: 363909
Length: 36

DNA sequence
>NC_014210, from 363874 to 363909 (36 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 TACGAGGAGTACGACGAGTACGGGGAGTACGACGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 363023-364726	Sequence	Ndas_0291 - hypothetical protein