Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 362783
End position: 362806
Length: 24

DNA sequence
>NC_014210, from 362783 to 362806 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CGGCTCCGGCTGAGGCTCCGGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 360517-362829	Sequence	Ndas_0290 - small GTP-binding protein (Protein is coded in complementary strand; from 362829 to 360517)