Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 3608673
End position: 3608702
Length: 30

DNA sequence
>NC_014210, from 3608673 to 3608702 (30 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CGCCGCCGTCGCCGCCACCGCGGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3608569-3610191	Sequence	Ndas_3021 - virulence factor MVIN family protein (Protein is coded in complementary strand; from 3610191 to 3608569)