Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 3391739
End position: 3391762
Length: 24

DNA sequence
>NC_014210, from 3391739 to 3391762 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 ACGAGCAGGAGCACGAACACCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3390164-3392386	Sequence	Ndas_2842 - drug exporter of the RND superfamily-like protein (Protein is coded in complementary strand; from 3392386 to 3390164)