Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 3379371
End position: 3379394
Length: 24

DNA sequence
>NC_014210, from 3379371 to 3379394 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GATGTCGAGGTCGATGCCGATGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3378607-3379674	Sequence	Ndas_2830 - uroporphyrinogen decarboxylase (Protein is coded in complementary strand; from 3379674 to 3378607)