Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 3339091
End position: 3339115
Length: 25

DNA sequence
>NC_014210, from 3339091 to 3339115 (25 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GCGGGGCGGAGCCGGGCGCGGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3338046-3339152	Sequence	Ndas_2796 - permease (Protein is coded in complementary strand; from 3339152 to 3338046)