Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 3231893
End position: 3231919
Length: 27

DNA sequence
>NC_014210, from 3231893 to 3231919 (27 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CCGGGGTTGCCGGGGTTGCCGGGGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3231623-3232624	Sequence	Ndas_2710 - endo-1,4-beta-xylanase (Protein is coded in complementary strand; from 3232624 to 3231623)