Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 3229645
End position: 3229668
Length: 24

DNA sequence
>NC_014210, from 3229645 to 3229668 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GGGCCAGGTCCATGGCCAGGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3229329-3229715	Sequence	Ndas_2707 - ankyrin (Protein is coded in complementary strand; from 3229715 to 3229329)